|  Help  |  About  |  Contact Us

Allele : Ddx19b<em1Chaw> DEAD box helicase 19b; endonuclease-mediated mutation 1, Changjiang Weng

Primary Identifier  MGI:6693701 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ddx19b
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Introns 1 and 5 were targeted with two sgRNAs (targeting TGGCTGTCTAAAGGAGACTGCGG and GATTCTACCATAAGGTCCCCAGG) using CRISPR/Cas9 technology, resulting in the deletion of 4,138 bp.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Ddx19b-Delta4138,
  • Ddx19b-Delta4138
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele