Primary Identifier | MGI:6460373 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Dlx4 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTCCAGAAGGGATAAATAC and ACACAAATCGCCAAGGGCCA, which resulted in a 2312 bp deletion beginning at Chromosome 11 position 95,140,139 bp and ending after 95,142,450 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000293308 and ENSMUSE00000336043 (exons 2 and 3) and 1098 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 95 and early truncation 44 amino acids later. |