Primary Identifier | MGI:6156435 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Sacs |
Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
Is Wild Type | false | Project Collection | IMPC |
molecularNote | This allele from project TCPR0556 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of AAGAAATAAGTTGCCCTCAT and ATACCTGATTGGATCAAGAT targeting the 5' side and CCAGTTGGTAGTATCCTTAG and CTTGCTCCCACTCTGAAGTG targeting the 3' side of exons ENSMUSE00000558006, ENSMUSE00000558005 and ENSMUSE00000558003. This resulted in a 6,799-bp deletion of Chr14 from 61178484 to 61185282 (GRCm38). |