Primary Identifier | MGI:6284346 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Depdc1a |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGTTTGTACTCAAACTGAA and TTTTCAAACCTAGTAACCAA, which resulted in a 750 bp deletion beginning at Chromosome 3 position 159,515,449 bp and ending after 159,516,198 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000399599 and ENSMUSE00000361974 (exons 4 and 5) and 497 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 157 and early truncation 10 amino acids later. |