| Primary Identifier | MGI:7345511 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Smim22 |
| Inheritance Mode | Not Specified | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GACTGTGTACGGCCAGAAAG and ACTGTGTTCTAATCCCGCCA, which resulted in a 643 bp deletion beginning at Chromosome 16 position 5,007,697 bp and ending after 5,008,339 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000997341, ENSMUSE00001018238, and ENSMUSE00001086134 (exons 2,3,4) and 296 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. |
