Primary Identifier | MGI:6303601 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Papolg |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTATTAACAGTAGTAAGATA and CAAAAACTAAAGAGAAGACG, which resulted in a 407 bp deletion beginning at Chromosome 11 position 23,885,389 bp and ending after 23,885,795 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001222705 (exon 4) and 325 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 82 and early truncation 13 amino acids later. |