| Primary Identifier | MGI:5763773 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fibin |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Fibin-7609J-M4502 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGAAAAGCGACTATCTGGA, GTAGGCATCCCCGATCTGGT, GCTGAGCCTCACTCTTCGAG and TCGCAGGCGCTGCTCCCAGG, which resulted in a 445 bp deletion in exon 1 beginning at Chromosome 2 negative strand position 110,362,610 bp, GCGCTGCTCCCAGGGGGAAGG, and ending after CTGAAAAGCGACTATCTGGAG at 110,362,166 bp (GRCm38/mm10). This mutation is predicted to cause a change of amino acid sequence after residue 62 and stop 39 amino acids later, due to read through into the 3UTR. |
