| Primary Identifier | MGI:5763136 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfyve1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Zfyve1-7570J-M3232 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCCTGACAAGATGAAGGCGT, ACACTGATGAGTCCCAGGCA, TTACGTTTACAGCGAAAGGG and ATAGTAGTCGTGCCTTACAT, which resulted in a 446 bp deletion spanning exon 4 beginning at Chromosome 12 negative strand position 83,569,169 bp, CTTACATAGGTAGAGTTAAAA, and ending after AGGATGCGCACGGCCTACGC at 83,568,724 bp (GRCm38/mm10). This mutation deletes exon 4 and 231 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid sequence change after residue 329 and early truncation 3 amino acids later. |
