| Primary Identifier | MGI:6724283 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence, Null/knockout | Gene | Fsip2 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A C was inserted into exon 16 (c.8137insC) using an sgRNA (targeting ATCAAGAACAAGTTATCTGCTGG) and an ssODN (AGCAGTACTAAGACCAAAATCAAGAACAAGTTAagcGCTGGAGAGAAAAcCTCCAAGAGAGAGCAGACCAAAACCGCCCTTGGGCTGCCACAAACTCCAC) with CRISPR/Cas9 technology. This mutation mimics a mutation found in multiple morphological abnormalities of the sperm flagella (MMAF) patients. Reduced transcript expression was confirmed by RT-qPCR and absence of peptide expression by immunostaining. |
