| Primary Identifier | MGI:6156591 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Shisa6 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR1026 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ACAAGAGGTTACTATCAATC and GGGTGCTTTGGGGGCATATA targeting the 5' side and GCAGTGGTGGATATCCTGAT and GACCTTGTCCGTCCCAGAGC targeting the 3' side of a critical region. This resulted in a 719-bp del Chr11:66502466 to 66503184 (GRCm38). |
