|  Help  |  About  |  Contact Us

Allele : Pole<em3Ewht> polymerase (DNA directed), epsilon; endonuclease-mediated mutation 3, Eileen White

Primary Identifier  MGI:7797733 Allele Type  Endonuclease-mediated
Attribute String  Conditional ready Gene  Pole
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Using CRISPR technology, a sgRNA (AGTGGAGGCTCAAGTGGCAT) was designed to target the Pole gene to introduce Lox-Stop-Lox cassette and a GTT to CTT mutation in exon 13 resulting in a valine to leucine change at amino acid 411 (V411L).
  • mutations:
  • Nucleotide substitutions,
  • Insertion
  • synonyms:
  • LSL-Pole V411L,
  • LSL-Pole V411L
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories