|  Help  |  About  |  Contact Us

Allele : Ccdc40<em1(IMPC)J> coiled-coil domain containing 40; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6382545 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ccdc40
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTCACAACCTTGATCAGGA and CCACTGTCCCATTTCTTACG, which resulted in a 489 bp deletion beginning at Chromosome 11 position 119,234,578 bp and ending after 119,235,066 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000389510 (exon 4) and 344 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 305 and early truncation 15 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele