| Primary Identifier | MGI:6361107 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc36a4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CACATCAGTTTTACCAGCAG and CCAAATGCTGTGTCCCTCAG, which resulted in a 365 bp deletion beginning at Chromosome 9 position 15,719,595 bp and ending after 15,719,959 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000341746 (exon 2) and 241 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 15 and early truncation 18 amino acids later. |
