Primary Identifier | MGI:7622033 | Allele Type | Endonuclease-mediated |
Attribute String | Humanized sequence | Gene | Apoe |
Strain of Origin | C57BL/6J | Is Recombinase | false |
Is Wild Type | false |
molecularNote | Using CRISPR/Cas9 technology, a guide RNA (gcacagaggagatacgggcg) was designed to produce a CGG to TCT missense mutation resulting in an arginine to serine mutation (R128S) in the apolipoprotein E (Apoe) gene. The missense mutation corresponds to the human SNP rs121918393 found in human APOE mature protein and is associated with an increased risk of Alzheimerâs disease (AD). |