| Primary Identifier | MGI:7276205 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Mlh1 |
| Strain of Origin | FVB/NJ x B6(Cg)-Tyr<c-2J>/J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using an sgRNA (targeting AGGACGACGGCCCGAAGGAA) and an ssODN template (AAGTGGCTGGACAGAGGACGACGGCCCGAAAGAGGGCCTTGCAGAGTACATTGTTGAGTTTCTGAAGAAGACAGCGGAGATGCTTGCAGACTATTTCTCTGTGGAGATCGATGAGGCGAG) with CRISPR/Cas9 technology, lysine codon 622 (AAA) was changed to threonine (ACA) (c.1865A>C, p.K622T). This is the equivalent of the human p.K618T mutation. |
