| Primary Identifier | MGI:5788425 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cxcl2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Cxcl2-7870J-M7781 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCGTGCATAAAAGGAGCTCT, CGTGCATAAAAGGAGCTCTC, GGGGATCATTATAAGGCACG and TCTTTAGGGTGAGCATGGGG, which resulted in a 510 bp deletion beginning at Chromosome 5 positive strand position 90,903,835 bp, ATCGTGCATAAAAGGAGCTC, and ending after TGCCTTATAATGATCCCCAC at 90,904,344 bp (GRCm38/mm10). This mutation deletes exons 1 and 2 and 235 bp of flanking intronic sequence including the transcriptional start, splice acceptor and donor, and is predicted to create a null allele. |
