| Primary Identifier | MGI:6108121 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ube2i |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences ACTCAGAAACTCAATAGCAG and GGGCTTGTGAAAAACACTGT, which resulted in a 954 bp deletion beginning at Chromosome 17 negative strand position 25,269,032 bp and ending after 25,268,079 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000207073 (exon 5) and 844 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 74 and early truncation 10 amino acids later. |
