| Primary Identifier | MGI:6294152 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rab3gap1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GACTTATCACAGTGGCTATT and TAGTACTGCATCTGAAGAAG, which resulted in a 500 bp deletion beginning at Chromosome 1 position 127,888,975 bp and ending after 127,889,474 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001274408 (exon 4) and 367 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 12 amino acids later. |
