Primary Identifier | MGI:5796285 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Gabarapl1 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele from project Gabarapl1-7880J-F7865 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATAAAAGTCATTCACCCTA, AACTACAAATTACCTATAAA, GGGTTGTCACTGCATGTAGG and GTGAGCTGGCCAGTACAGAT, which resulted in a 368 bp deletion beginning at Chromosome 6 positive strand position 129,537,347 bp, GTAATTTGTAGTTGTTTAAA, and ending after GAGCTGGCCAGTACAGATAG at 129,537,714 bp (GRCm38/mm10). This mutation deletes exon 2 and 79 bp of flanking intronic sequence including the splice acceptor and donor. There is a single bp insertion G at the deletion site that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 30 and early truncation 6 amino acids later. |