|  Help  |  About  |  Contact Us

Allele : Tns2<em1Nsas> tensin 2; endonuclease-mediated mutation 1, Nobuya Sasaki

Primary Identifier  MGI:6117704 Allele Type  Endonuclease-mediated
Gene  Tns2 Strain of Origin  (C57BL/6 x DBA/2)F1
Is Recombinase  false Is Wild Type  false
molecularNote  Exon 22 was targeted using an sgRNA (targeting AGAGACAGCCATTCATTCCAAGG) using CRISPR/Cas9 technology resulting in a 5 bp deletion (GRCm39:chr15:102022204_102022208delTTCCA) in the M3 founder line, creating a frame-shift and premature stop codon (p.F1168Rfs*48). Both the C-terminal Src homology (SH2) and phosphotyrosine binding (PTB) domains in the encoded peptide are affected.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Tns2<deltaC>,
  • Tns2<deltaC>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele