Primary Identifier | MGI:6117704 | Allele Type | Endonuclease-mediated |
Gene | Tns2 | Strain of Origin | (C57BL/6 x DBA/2)F1 |
Is Recombinase | false | Is Wild Type | false |
molecularNote | Exon 22 was targeted using an sgRNA (targeting AGAGACAGCCATTCATTCCAAGG) using CRISPR/Cas9 technology resulting in a 5 bp deletion (GRCm39:chr15:102022204_102022208delTTCCA) in the M3 founder line, creating a frame-shift and premature stop codon (p.F1168Rfs*48). Both the C-terminal Src homology (SH2) and phosphotyrosine binding (PTB) domains in the encoded peptide are affected. |