| Primary Identifier | MGI:6147827 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Hnrnph2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences CACCATGATGCTGAGCACAG and TTGAGTTTTCCTGAAGAACT which resulted in a 1451 bp deletion beginning at Chromosome X position 134,604,908 bp and ending after 134,606,358 bp (GRCm38/mm10). This mutation deletes most of the coding sequence of ENSMUSE00000653740 (exon 4) leaving 53 bp of 5' UTR with the deletion beginning just before the ATG and ending in the 3' UTR 100 bp after the TAA stop. This is predicted to result in a null allele. |
