| Primary Identifier | MGI:5644523 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Klra7 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Klra7-6781J-M7991 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences: TCTTGTACTTGTGCATAACC, CAGTCCTCACTAGTTTCTGC and GACATGGACTGACCAAATT which resulted in a 241 bp deletion beginning in 5 upstream sequence at Chromosome 6 negative strand position 130,231,784 bp, beginning TCAGGGTGTTTATAGCATTAAG, and ending after GTTGCAGAAACTAGTGAGGAC in exon 1 at 130,231,544 bp (GRCm38/mm10). This mutation deletes the 5-prime UTR region and part of exon 1 and is predicted to not produce a protein product. |
