| First Author | Levinson B | Year | 1997 |
| Journal | Mouse Genome | Volume | 95 |
| Issue | 1 | Pages | 163-5 |
| Mgi Jnum | J:39098 | Mgi Id | MGI:86479 |
| Citation | Levinson B, et al. (1997) Mutation analysis of mottled pewter. Mouse Genome 95(1):163-5 |
| abstractText | Full text of Mouse Genome contribution: MUTATION ANALYSIS OF MOTTLED PEWTER. Barbara Levinsonl, Seymour Packman2, and Jane Gitschier1, 2, 3. 1Howard Hughes Medical Institute, Department of Pediatrics, 3 Department of Medicine, University of California, San Francisco, CA 94143, USA Introduction The X-linked mouse mottled mutants were originally described in 1953 by Fraser and subsequently thought to be homologues of the human Menkes disease1. In 1994 the murine Atp7a cDNA was cloned by its homology to the human Menkes disease gene (ATP7A) and alterations in mRNA expression in the blotchy and dappled mottled alleles were reported2, 3. Later the splice-site mutation responsible for the blotchy mottled phenotype was described, confirming Atp7a as the causative gene in the mottled mouse4. Recently the mutations responsible for mottled brindled and mottled viable-brindled also have been determined by sequence analysis (B. Levinson, unpublished, J. Mercer, personal communication and ref. 5). The phenotypes of the 20-30 known mottled mice vary from in utero lethal to the mildest mottled phenotype seen in pewter. The pewter allele arose in the CBA/J strain and exhibits a phenotype which appears to be restricted to a pale, silvery coat color in the affected males6. Previously we reported the presence of Atp7a mRNA from pewter brain tissue of approximately normal size and amount on a northern blot2. This report describes the identification of a unique missense mutation in the Atp7aMo-pew allele occurring in the conserved transduction domain of the copper-transporting ATPase. Materials and Methods Poly(A+) RNA was isolated using a Pharmacia QuickPrep mRNA kit from kidney tissue from a mottled pewter male purchased from The Jackson Laboratory. The mRNA was reverse transcribed using an Invitrogen cDNA kit and random primers. The resulting cDNA was amplified into four overlapping segments with the following primers: segment 1 nt 54-1 3 2 6, 5 ' ÐC A G A G C T C G A A C C C C A G C C C T G and 5' - CAATAGTCCCTGTGCTGTTTGCG and followed by a nested PCR with primers 5'- CCAGGGCTGGGGTTCGAGCTCTGGA and 5'-CTGTTTGCGAGGGACACGTGG, segment 2 nt 1026-2451 5' -GTGCTTTATCTACACTCCAG and 5'- GTTCCAGCCATCGTCCTAGTGCG and heminested with 5' primer 5'- GGTCAGCCATTGTAAAGTAC, segment 3 nt 2241-3547 5' GTGTCTACCTGTACAGTTTTG and 5'-CGGTTACCAATGAGGACTTTG and nested with 5 ' ÐG G T A C T T C T A C A T T C A G G C T T A C and 5' - GCATTTGAGAGATGAGCATCAATG, segment 4 nt 3329-4662 with primers 5'- CAATAAGATCCTGGCCATTGTGGGG and 5'-CCTTGCACGTAAGAGCATGAC and heminested with 5' primer 5'-GAACATCCTTTAGGAGCAGCTG. The resulting cDNA PCR products were analyzed on 2-3% agarose gels and were all of the expected size. The segments were sequenced on both strands using an Applied Biosystems PRISM TM 377 DNA sequencer. Genomic DNA was isolated from a pewter male mouse tail, and from cells cultured from mottled macular, mottled dappled, and mottled brindled mice by standard methods. The following genomic DNA samples were purchased from The Jackson Laboratory: CBA/J-Atp7aMo-pew, CBA/J, C57Bl/6J-Atp7aMo-pew2J (an independently arising mottled allele with a pewter-like phenotype), C57BL/6J, C3H/HeJ, Balb/cJ. The DNA samples were amplified with primers specific for exon 15 (5'- GCTATAATAGAAGCATCTCCCG, 5'- GAGCCATTTCCAGTGGCTCCC)7. Five ul of the PCR products were denatured, neutralized and blotted onto Amersham Hybond-N nylon filter paper, and hybridized in duplicate to two 32p end labeled 15-mer oligonucleotide probes, one of the wild type sequence (5Õ- GGACTAGCCACTCCA) and the other mutant sequence (5Õ ÐGGACTAACCACTCCA). The blots were washed using tetramethylammonium chloride (TMAC) at 49 degrees C as described8. Results The four PCR products generated from the pewter cDNA were of the predicted sizes, suggesting that the pewter mutation, unlike that of blotchy, does not affect a splice site. Sequence analysis of the four overlapping cDNA fragments revealed only a single base change at nucleotide 3074 in exon 15 in pewter. This G to A transition results in the substitution of a threonine for an alanine in the transduction domain. To insure that this missense mutation was not a polymorphism or a reverse transcription or PCR error, we amplified exon 15 from a series of mouse genomic DNAs purchased from The Jackson Laboratory or prepared in our laboratory as described in methods. These PCR products were hybridized to wild-type and mutant oligomers as described in methods. Only the mottled pewter DNA isolated from the mutant mouse and the CBA/J-Atp7aMo-pew DNA from The Jackson Laboratory had a positive signal with the mutant oligonucleotide and were negative when hybridized to the wild type oligonucleotide probe (data not shown). Discussion This report identifies a unique nucleotide change present in the cDNA and genome of mottled pewter that is found in no other assayed mouse strain. We suggest that the mottled pewter phenotype results from this single base G to A transition. The replacement of alanine in the wild-type animal by threonine in pewter changes a non-polar hydrophobic amino acid to a polar neutral amino acid. It is interesting to speculate on the influence of this mutation on the ATPase activity, culminating in the mild phenotype of pewter. The mutated alanine resides in the highly conserved transduction sequence CPCSLGLA (with the mutated alanine in bold) in the sixth transmembrane domain of the ATPase as shown in figure 1. The two cysteines in this sequence are putatively responsible for copper- binding and the proline is likely to mediate the conformational change associated with copper transport. Twenty-one known or presumed copper-transporting ATPases have been reported and all of them have the identical sequence (with the exception of the serine position) CPCSLGLA. It is interesting to note that a related group of cadmium transporters utilize serine, or in one case threonine, instead of the alanine, suggesting that the alanine may be important for the efficient transport of copper. Fig. 1 (Legend) A model of the mottled copper-transporting ATPase. The transduction sequence, located in the sixth transmembrane domain, is shown as a cross-hatched section. The conserved amino acids are positioned under the transduction label and the A to T substitution in mottled pewter is indicated. Acknowledgments We thank Martha Gunthorpe for technical assistance and Christopher Vulpe for helpful discussions. This work was supported by the Howard Hughes Medical Institute and a grant from the National Institutes of Health. References 1. Fraser AS, Sobey S & Spicer CC. J of Genet 51, 217-221 (1953). 2. Levinson B et al. Nature Genet 6, 369-373 (1994). 3. Mercer JFB et al. Nature Genet 6, 374-378 (1994). 4. Das S et al. Am J Hum Genet 56, 570-576 (1995). 5. Reed V, Masson W, Cunliffe P, Horn N & Boyd Y. Am J Hum Genet 59, A281 (1996). 6. Fox S & Eicher EM. Mouse Newsletter 58, 47 (1978). 7. Cecchi C & Avner P. Genomics 37, 96-104 (1996). 8. Wood WI, Gitschier J, Lasky LA & Lawn RM. Proc Natl Acad Sci USA. 82, 1585-1588 (1985). |
