Primary Identifier | MGI:6121489 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Samd11 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTGCAGTGGACCTTGAACG, TAGAGCTGCCCCGAGAGCAG, CCTACGGGAGCTTATCAGGG and CATCTTGGTGAGCAGGGCAT, which resulted in a 519 bp deletion beginning at Chromosome 4 position 156,250,058 bp and ending after 156,250,576 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001049485 (exon 5) and 356 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 106 and early truncation 19 amino acids later. |