Primary Identifier | MGI:6361033 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Cog8 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATCATCAGCTTGAGGCCCCT and TACCAAGCACTTACTAGACA, which resulted in a 298 bp deletion beginning at Chromosome 8 position 107,054,004 bp and ending after 107,054,301 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001242994 (exon 2) and 90 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 132 and early truncation 2 amino acids later. There is a 4 bp insertion (GACG) at the deletion site. |