Primary Identifier | MGI:7330390 | Allele Type | Endonuclease-mediated |
Attribute String | Modified regulatory region | Gene | Rr249 |
Strain of Origin | C57BL/6J | Is Recombinase | false |
Is Wild Type | false |
molecularNote | The intronic Gata2 enhancer was targeted with an sgRNA (targeting TCTCCTGCCGGAGTTTCCTATCCGG) and an ssODN template (TTTCAAAACAGCCCAGCAAGAGGCAGGACTGAGTCGAGGTGGCTCTGAAAACTTGCCGGTCCAGAAACAGATACACGAAGTTTCCTTATCTACCGGCTGCAGATGTCCGGATAGGAAACTCCGGC) using CRISPR/Cas9 technology, resulting in a C-to-T mutation disabling the Ets motif TTCC by changing it to TTCT. |