| Primary Identifier | MGI:7562028 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zc3h12a |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Serine codon 513 (TCT) in exon 6 was targeted for change to alanine (GCT) (p.S513A) using sgRNAs (targeting GTGGGTGGGGGTAATGGGTA and CCTACCCATCCAGAGTAC) and an ssODN template with CRISPR/Cas9 technology. This allele represents an untargeted 1 bp deletion (one of 3 Cs (G on forward strand) at GRCm39:chr4:125013313-125013315) that leads to a frameshift and premature stop codon (p.P517Hfs*50). Expressed peptides lack the C terminal domain (CTD) and part of the proline-rich region. |
