| Primary Identifier | MGI:7512906 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gabpb2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGGATCTTACACGGATTGAA targeting the 5' side and ATGGCCTCGTACACGCAACC targeting the 3' side of a critical region (ENSMUSE00000494767 and ENSMUSE00001271433). This resulted in a 3959-bp deletion of Chr3 from 95107302 to 95111260 (GRCm39) introducing a frameshift and premature stop codon. |
