|  Help  |  About  |  Contact Us

Allele : Lacc1<em1Flv> laccase domain containing 1; endonuclease-mediated mutation 1, Richard A Flavell

Primary Identifier  MGI:7539559 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Lacc1
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  Exons 3 and 7 were targeted with sgRNAs (targeting AAACTGCCATGAGACCTTACTGG and GTTAAGGCCATCGCGGACATGGG) using CRISPR/Cas9 technology, resulting in a deletion.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Lacc1<->,
  • Lacc1<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele