| Primary Identifier | MGI:5659623 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Abca16 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Abca16-6894J-M2454 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, GTTTCATCTCTAAAGTCACT, TAACTTGTCTGGCCACCAGA and CAAGCTACTACTGTTATGCC, which resulted in a 112 bp deletion beginning in intron 2 at Chromosome 7 positive strand position 120,431,039 bp, at ACTTGGTTTTCTACTGGGATGTA, and ending after TTGGTGCACAGAGGACCATCT at position 120,431,150 bp in exon 2 (GRCm38). This mutation deletes 43 bp in exon 2 as well as the splice acceptor to essentially delete the exon. This mutation is predicted to cause amino acid sequence changes after residue 20 and early truncation 43 amino acids later. |
