|  Help  |  About  |  Contact Us

Allele : Adora2a<em2(IMPC)H> adenosine A2a receptor; endonuclease-mediated mutation 2, Harwell

Primary Identifier  MGI:6266828 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Adora2a
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NTac
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences CCGATACGGCATGCTGCCACTGT, CCTGGTTCCGATACGGCATGCTG, GAGTGAGAACGATGTATCTTTGG, ACGATGTATCTTTGGTAATGGGG, which resulted in a Exon Deletion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele