| Primary Identifier | MGI:7855638 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr594 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Hypothalamic neuron-specific Pomc enhancer nPE3, located upstream, was targeted using sgRNAs (equivalent to CCTGTGTGGACGCCCGCCTGAGG and TCCTTCAGCTGGTTCCAAGGAGG) with CRISPR/Cas9 technology, resulting in its deletion. This allele was created in zygotes heterozygous for the Rr596tm1.1Low allele (where enhancers Rr279 (nPE1) and Rr280 (nPE2) are deleted). Eight founder mice were created, with four different deletions and one deletion-insertion amongst them. A founder strain carrying a 634 bp deletion (GRCm39:chr12:3986460-3987093)of nPE3 (Rr594) in addition to the Rr596tm1.1Low allele was selected. |