|  Help  |  About  |  Contact Us

Allele : Rr594<em2Mrub> regulatory region 594; endonuclease-mediated mutation 2, Marcelo Rubinstein

Primary Identifier  MGI:7855638 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr594
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Hypothalamic neuron-specific Pomc enhancer nPE3, located upstream, was targeted using sgRNAs (equivalent to CCTGTGTGGACGCCCGCCTGAGG and TCCTTCAGCTGGTTCCAAGGAGG) with CRISPR/Cas9 technology, resulting in its deletion. This allele was created in zygotes heterozygous for the Rr596tm1.1Low allele (where enhancers Rr279 (nPE1) and Rr280 (nPE2) are deleted). Eight founder mice were created, with four different deletions and one deletion-insertion amongst them. A founder strain carrying a 634 bp deletion (GRCm39:chr12:3986460-3987093)of nPE3 (Rr594) in addition to the Rr596tm1.1Low allele was selected.
  • mutations:
  • Deletion
  • synonyms:
  • Pomc<deltanPE1.deltanPE2.deltanPE3>,
  • Pomc<deltanPE1.deltanPE2.deltanPE3>,
  • delta1delta2delta3,
  • delta1delta2delta3
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele