| Primary Identifier | MGI:5578313 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Eogt |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Eogt-5785J-8958 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence TCTGAGGCTGACGATGCGCC, which resulted in a 25 bp deletion AGGCTGACGATGCGCCTGGCAAGGC in exon 4 beginning at Chromosome 6 negative strand position 97145373 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. |