| Primary Identifier | MGI:5576237 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Krt77 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele, from project Krt77-5764J-0643, was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence CACTGGCACTTCGTCCCACT, which resulted in an 10 bp deletion GTGGGACGAA in exon1 beginning at Chromosome 15 negative strand position 101,869,384 bp (GRCm38) and is predicted to cause amino acid changes after residue 70 and a frameshift mutation with early truncation 68 residues later. |
