|  Help  |  About  |  Contact Us

Allele : Bmp2k<em1(IMPC)J> BMP2 inducible kinase; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5584154 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Bmp2k
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Bmp2k-5786J-8977 was generated at The Jackson Laboratory by injecting Cas9 nickase RNA and left guide sequence GGCGAACACCCGGACCCCCA and right guide sequence CGGCCGCTACCAGGTCACCC, which resulted in an 163 bp deletion in exon1 beginning at CGCGGGCGGCGGGCTCGGCGGCG at Chromosome 5 positive strand position 96,997,992 bp (GRCm38/mm10) and extending through CGGGGTGTGGCGGCGGCTGCGGGGCC at 96,998,155 bp and is predicted to cause a frameshift mutation with early truncation.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Bmp2k<em1J>,
  • Bmp2k<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele