|  Help  |  About  |  Contact Us

Allele : Myh10<em1(IMPC)J> myosin, heavy polypeptide 10, non-muscle; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5604248 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Myh10
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Myh10-6078J-P4M2R was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GTCCACAAAGAGATACCTCT, which resulted in a 4 bp deletion GGTA in exon 2 beginning at Chromosome 11 positive strand position 68699275bp (GRCm38) and is predicted to cause amino acid sequence changes after residue 11 and an early truncation 66 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Myh10<em1J>,
  • Myh10<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele