|  Help  |  About  |  Contact Us

Allele : Dolk<em1(IMPC)J> dolichol kinase; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5605979 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Dolk
Strain of Origin  C57BL/6NJ Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project Dolk-5942-1899 was generated at The Jackson Laboratory by injecting Cas9 D10 (nickase) RNA and guide sequences CGTAGAAGGCCTGCACCGCG and ACGTCCAGTACAAGTGGGAC, which resulted in a 25 bp deletion in exon 1 beginning at Chromosome 2 negative strand position 30285881 (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 50 and early truncation 32 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Dolk<->,
  • Dolk<em1J>,
  • Dolk<->,
  • Dolk<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

6 Publication categories

Trail: Allele