| Primary Identifier | MGI:5607861 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp219 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Zfp219-6028J-P3MR was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GATCTGCAGCGCTACTCCAA, which resulted in a 19 bp deletion CGCTACTCCAACGGACCAG in exon 2 beginning at Chromosome 14 negative strand position 52,009,555 bp (GRCm38), which is predicted to cause amino acid sequence changes after residue 25 and early truncation 46 amino acids later. |
