| Primary Identifier | MGI:5607865 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pcdh12 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Pcdh12-6034J-P3MB was generated at The Jackson Laboratory by injecting Cas9 nickase RNA and guide sequences GTAGCATCATGCTTACCGGC and CATTCCTGCTAGGGCTCTTA, which resulted in a 38 bp deletion GCCATTCCTGCTAGGGCTCTTAGGGCCAGGAAGCTACT in exon1 beginning at Chromosome 18 negative strand position 38,284,057 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 5 and early truncation 63 amino acids later. |
