| Primary Identifier | MGI:5607785 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ttll10 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Ttll10-5999J-P5ML was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence AAAGATGGCCCTACACCCAC, which resulted in an 8 bp deletion CACAGGCC in exon3 beginning at Chromosome 4 negative strand position 156,048,583 bp (GRCm38), which is predicted to cause amino acid sequence changes after residue 4 and early truncation 72 amino acids later. |
