|  Help  |  About  |  Contact Us

Allele : Ttll10<em1(IMPC)J> tubulin tyrosine ligase-like family, member 10; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5607785 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ttll10
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Ttll10-5999J-P5ML was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence AAAGATGGCCCTACACCCAC, which resulted in an 8 bp deletion CACAGGCC in exon3 beginning at Chromosome 4 negative strand position 156,048,583 bp (GRCm38), which is predicted to cause amino acid sequence changes after residue 4 and early truncation 72 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Ttll10<em1J>,
  • Ttll10<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele