|  Help  |  About  |  Contact Us

Allele : Ubn1<em1(IMPC)J> ubinuclein 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5629302 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ubn1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Ubn1-6239J-105P8MR was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence ACGTAGGAAAGACCGAATAC which resulted in a 7 bp deletion ACCGAAT in exon 5 beginning at Chromosome 16 positive strand position 5,062,557 - 5,062,563 bp (GRCm38) that is predicted to cause amino acid sequence changes after residue 121 and early truncation 1 amino acid later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Ubn1<em1J>,
  • Ubn1<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele