|  Help  |  About  |  Contact Us

Allele : Trip13<em1(IMPC)J> thyroid hormone receptor interactor 13; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5639079 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Trip13
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Trip13-6637J-2781F was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, CACTAAAGTATAGCTAGGTC, TTGTGTTTGGAGATTACGTC and CGGGTTACTACCCTATCTGT which resulted in a 556bp deletion beginning in intron 1 at CTAGCTATACTTTAGTGGG at Chromosome 13 negative strand position 73,936,559 bp (GRCm38) and ending after TAGCGGGTTACTACCCTATC at position 73,936,004 bp in intron 2. This mutation deletes exon 2 and is predicted to cause amino acid sequence changes after residue 31 and early truncation 3 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Trip13<em1J>,
  • Trip13<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele