| Primary Identifier | MGI:5644522 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rnf10 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Rnf10-6732J-M6624 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences: GTGAATTGGAGCGACGGGAC, AGACACGGCCAATTTCTATC and GCACGCACTCACACTTTGAC, (along with a plasmid containing 1 kb homology arms flanking the floxed critical exon, which did not integrate) which resulted in a 302 bp deletion beginning in intron 2 at Chromosome 5 negative strand position 115,260,367 bp at GCCGTGTCTGGGAAAACATTAAA and ending after CCTGTCAAAGTGTGAGTGCGTG in intron 3 at 115,260,066 bp (GRCm38/mm10). This mutation deletes all of exon 2 and is predicted to cause amino acid sequence changes after 52 residues and early truncation 9 amino acid residues later. PCR failed to detect the insertion of any loxP sites. |
