| Primary Identifier | MGI:5659670 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Vopp1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Vopp1-6899J-M261 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, CCTATAAAAGAAACCGCTCC, CTGAGGCCAAAAAACATTGC and TACACTACTGAAAAGGTCTC, which resulted in a 93 bp deletion beginning in exon 2 at Chromosome 6 negative strand position 57,790,014 bp, at TGCTGGTATTTTGAAGGACT, and ending after TCAGTTTTTTTTCTCCAGGA at position 57,789,922 bp in intron 3 (GRCm38). This mutation deletes 38 bp in exon 2 as well as the splice donor to essentially delete the exon. This mutation is predicted to cause amino acid sequence changes after residue 25 and with read through into the intron, early truncation 24 amino acids later. |
