| Primary Identifier | MGI:5649017 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ccdc78 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Ccdc78-6895J-M2468 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, GATCCTTCTTTAGGGGATGA, CAGGACAACTGGTCAGCAAC and CTTGGGTACTCCCAGGTGCT, which resulted in a 205 bp deletion beginning in intron 6 at Chromosome 17 positive strand position 25,787,901 bp, beginning at GGATGACGGATGACCTCACCC, and ending after AAACAGAGCAATCGCCTCTTG at position 25,788,105 bp in intron 7 (GRCm38). This mutation deletes exon 6 and is predicted to cause amino acid sequence changes after residue 167 and early truncation 22 amino acids later. |
