| Primary Identifier | MGI:5649018 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nt5dc1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Nt5dc1-6897-M2486 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, CAGGGGATGCAGGTGAACAA, TTCTCCTTGACTAAGAACTG and AGCAGAATCACTAATGGGGT which resulted in a 204 bp deletion beginning in intron 2 at Chromosome 10 negative strand position 34,411,544 bp, at ATTCTGCTAGGATTTTAGGTC, and ending after TCCAACCCCTTGTTCACCTG at position 34,411,341 bp in intron 3 (GRCm38). This mutation deletes 85bp from intron 2, deletes exon2 (92bp) and 27bp in intron 3. The deletion of exon 2 predicts a change in amino acid sequence after amino acid residue 32 and early truncation 13 residues later. |
