| Primary Identifier | MGI:5662540 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Galnt12 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Galnt12- 6964J-M4370 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: GCTTGCTCTGCCAAAGACGT, TGCTTGCTCTGCCAAAGACG, AAGCAAGGACAGATTCACCT, GGAACTCTGTGATGGTACAA, which resulted in a 347 bp deletion beginning in intron 3 at Chromosome 4 positive strand position 47,108,346 bp, GCCAAAGACGTGGGACAATGACC, and ending after ACTCTGTGATGGTACAATG at position 47,108,692 bp (GRCm38/mm10) in intron 4. This mutation deletes exon 3 and is predicted to cause an amino acid change after 175 amino acids and early truncation 15 residues later. |