| Primary Identifier | MGI:5662543 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Egfem1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Egfem1-6963J-F4337 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: GCAGGGTTTGAATTAGAGGG, TGGGAGGTAGACGAATAAGA, GACAAGTTATATGTTACAAG, CTTGTAACATATAACTTGTC, which resulted in a 273bp deletion beginning in intron 3 at Chromosome 3 positive strand position 29,151,713 bp, ATTCGTCTACCTCCCAATGTATGT, and ending after CTTCCTGACAAGTTATATGTTAC at 29,151,985 bp (GRCm38/mm10) in intron 4. This mutation results in the deletion of exon3 and is predicted to cause a change in amino acid sequence after residue 74 and early truncation 35 amino acids later. |
