| Primary Identifier | MGI:5688574 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp422 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Zfp422-7040J-M1223 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, CCACACTCATCACAGCAGTA and GTGGCCATTCGCTTCGACTC, which resulted in a 301 bp deletion beginning in exon 2 at Chromosome 6 negative strand position 116,626,917bp, CTCGGGCTTGAGTCGACGGA, and ending after ACCGGCGAGAAGCCCTACTGC at 116,626,617 bp (GRCm38/mm10) in exon 2. This mutation results in the deletion of 301 bp in exon 2 and results in an amino acid sequence change after residue 40 and early truncation 41 amino acids later. |
