|  Help  |  About  |  Contact Us

Allele : Arap3<em1(IMPC)J> ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5688575 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Arap3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Arap3-7000J-M3454 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, AGGGGTCTGATCCCGAGGAG, GCATCAGTGCTACAGGACAC, and AAAGTCTGAGGCTTGGACAG, which resulted in a 775bp deletion beginning in intron 2 at Chromosome 18 negative strand position 37,997,244 bp, TTTGGGCATTCTTCTTTGAAAGAGAT, and ending after ATTTCCTTTCAGGACTCCAGATA at 37,996,470 bp (GRCm38/mm10) in exon 3. This mutation results in the deletion of exon 2, which includes the start of translation, intervening intron and 11 bp in exon 3 and is predicted to be a null allele.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Arap3<em1J>,
  • Arap3<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele